Review



bio rad cfx 193 opus 96  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Bio-Rad bio rad cfx 193 opus 96
    Bio Rad Cfx 193 Opus 96, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 22525 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/CFX96+Touch+Deep+Well+Real-Time+PCR+Detection+System/pm42096515-90-12-12
    Average 96 stars, based on 22525 article reviews
    bio rad cfx 193 opus 96 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    cDNA Synthesis:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    Isolation:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    Article Title: Saliva-STAT: Sample-to-answer saliva test for COVID-19.
    Article Snippet: RT-qPCR reactions were assembled using a GoTaq® 1-Step RT-qPCR system (Promega), 1X SYBR Green 1, and 500 nM primers (nCOV_N1, IDT). .. 5 μL of extracted RNA was added to RT-qPCR reactions (20 μL total, N=5), and fluorescence was measured for 40 cycles in a CFX Opus 96 Real Time PCR system (BIO-RAD). ..

    Article Title: Establishment and Quantification of De Novo Lytic Infection by Cell-free Kaposi’s Sarcoma-Associated Herpesvirus
    Article Snippet: .. CFX Opus 96 Real-time PCR System , Bio-Rad , 184–5072 , . .. LSR II 18 flow cytometer , BD Bioscience , N/A , .

    Article Title: DJ-1-mediated repression of the RNA-binding protein FMRP is predicted to impact known AD-related protein networks
    Article Snippet: For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), as previously described, with total RNA isolated from RIP. .. 14 qPCR amplification was performed using SsoAdvanced Universal SYBR ® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Fmr1 (Forward 5’- CCGAACAGATAATCGTCCACG- 3’; Reverse 5’ -ACGCTGTCTGGCTTTTCCTTC −3’). ..

    Article Title: Protocol for the site-specific isolation of mouse endothelial cells using the modified Häutchen technique
    Article Snippet: Hard-Shell 96-well PCR plate , Bio-Rad , HSP9655. .. CFX Opus 96 real-time PCR system , Bio-Rad , 12011319. ..

    Article Title: Chromosome‐level genome of Zoysia sinica in the intertidal zone reveals genomic insights into waterlogging stress adaptation
    Article Snippet: For RNA‐seq validation, 1 μg of total RNA was converted to cDNA using the SensiFAST cDNA Synthesis Kit (Meridian Bioscience) following the manufacturer's instructions. .. The synthesized cDNA was used for qRT‐PCR with the SensiFAST SYBR Lo‐ROX Kit (Meridian Bioscience) on the CFX Opus 96 Real‐Time PCR System (Bio‐Rad Laboratories, Inc.), using HTA11 as the housekeeping gene, which exhibited uniform trimmed mean of M‐values‐normalized TPM values across all conditions. ..

    Article Title: Ophidiomycosis Prevalence and Disease Ecology in a Natrix tessellata (Laurenti, 1768) Population From Northern Italy.
    Article Snippet: Fungal pathogens pose a growing threat to vertebrate biodiversity.. In snakes, Ophidiomyces ophidiicola (Oo) has garnered particular concern, although its impact in Europe remains poorly understood.. We conducted a season‐long, standardized survey of dice snakes (Natrix tessellata) along the northern shore of Lake Como (Italy) to quantify Oo and ophidiomycosis prevalence, identify the circulating strain, and explore the association with environmental, morphological and behavioral traits.

    Article Title: Influence of Bottle Gourd Cultivars on the Biology and Demographic Parameters of Helicoverpa Armigera (Hübner, 1809): Basis of Resistance Through Biochemical and Physiological Approach.
    Article Snippet: South America, Eastern Europe and especially in India (Brdar‐Jokanović et al. 2024).. Bottle gourd is a vital source of energy (15 ± 0.12% dry weight) due to the presence of proteins, carbohydrates and fats, representing 3.75 ± 0.03, 1.2 ± 0.06 and 0.2 ± 0.02% of dry weight, respectively (Wu et al. 2017).. Young stems and leaves of bottle gourd plants are also cooked as vegetables.

    Amplification:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    Article Title: DJ-1-mediated repression of the RNA-binding protein FMRP is predicted to impact known AD-related protein networks
    Article Snippet: For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), as previously described, with total RNA isolated from RIP. .. 14 qPCR amplification was performed using SsoAdvanced Universal SYBR ® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Fmr1 (Forward 5’- CCGAACAGATAATCGTCCACG- 3’; Reverse 5’ -ACGCTGTCTGGCTTTTCCTTC −3’). ..

    SYBR Green Assay:

    Article Title: Aberrant DJ-1 expression underlies L-type calcium channel hypoactivity in dendrites in tuberous sclerosis complex and Alzheimer’s disease
    Article Snippet: .. For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), according to the manufacturer’s instructions with total RNA isolated from RIP. qPCR amplification was performed using SsoAdvanced Universal SYBR® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Cacna1c (5’- GCTGTGTTACTGCTGTTCAGG -3’, antisense 5’- TGAGAGATGTCTCCCCCTTGAT -3’), Cacna1d (5’-CGGAACAAGAACAGCGACAA3’, antisense 5’-CTGGCAGCACTTTCCATCTC-3’), Cacna2d2 (5’- ACGCCCGCTCTTGCTCTTGCT-3’, antisense 5’- CCTCCAAAAATCCGCATCAC -3’), Cacna2d1 (5’- GACCTTGTCACACTGGCAAA-3’, antisense 5’- GGCTGCTTGGACTTTCTCTG-3’), Akt1 (5’-TCCTCAAGAACGATGGCACC-3’, antisense 5’- CTGCAGGCAGCGGATGATAA -3’), and Gapdh (5’- GGTGCTGAGTATGTCGTGGA-3’, antisense 5’-CCTTCCACAATGCCAAAGTT-3’). ..

    Article Title: DJ-1-mediated repression of the RNA-binding protein FMRP is predicted to impact known AD-related protein networks
    Article Snippet: For RIP, reverse transcription was performed using SMARTer cDNA synthesis kit (TakaraBio), as previously described, with total RNA isolated from RIP. .. 14 qPCR amplification was performed using SsoAdvanced Universal SYBR ® Green Supermix, with CFX Opus 96 Real Time PCR system (BioRad), with gene specific primers for Fmr1 (Forward 5’- CCGAACAGATAATCGTCCACG- 3’; Reverse 5’ -ACGCTGTCTGGCTTTTCCTTC −3’). ..

    Quantitative RT-PCR:

    Article Title: Saliva-STAT: Sample-to-answer saliva test for COVID-19.
    Article Snippet: RT-qPCR reactions were assembled using a GoTaq® 1-Step RT-qPCR system (Promega), 1X SYBR Green 1, and 500 nM primers (nCOV_N1, IDT). .. 5 μL of extracted RNA was added to RT-qPCR reactions (20 μL total, N=5), and fluorescence was measured for 40 cycles in a CFX Opus 96 Real Time PCR system (BIO-RAD). ..

    Fluorescence:

    Article Title: Saliva-STAT: Sample-to-answer saliva test for COVID-19.
    Article Snippet: RT-qPCR reactions were assembled using a GoTaq® 1-Step RT-qPCR system (Promega), 1X SYBR Green 1, and 500 nM primers (nCOV_N1, IDT). .. 5 μL of extracted RNA was added to RT-qPCR reactions (20 μL total, N=5), and fluorescence was measured for 40 cycles in a CFX Opus 96 Real Time PCR system (BIO-RAD). ..

    Synthesized:

    Article Title: Chromosome‐level genome of Zoysia sinica in the intertidal zone reveals genomic insights into waterlogging stress adaptation
    Article Snippet: For RNA‐seq validation, 1 μg of total RNA was converted to cDNA using the SensiFAST cDNA Synthesis Kit (Meridian Bioscience) following the manufacturer's instructions. .. The synthesized cDNA was used for qRT‐PCR with the SensiFAST SYBR Lo‐ROX Kit (Meridian Bioscience) on the CFX Opus 96 Real‐Time PCR System (Bio‐Rad Laboratories, Inc.), using HTA11 as the housekeeping gene, which exhibited uniform trimmed mean of M‐values‐normalized TPM values across all conditions. ..

    High Performance Liquid Chromatography:

    Article Title: Ophidiomycosis Prevalence and Disease Ecology in a Natrix tessellata (Laurenti, 1768) Population From Northern Italy.
    Article Snippet: Fungal pathogens pose a growing threat to vertebrate biodiversity.. In snakes, Ophidiomyces ophidiicola (Oo) has garnered particular concern, although its impact in Europe remains poorly understood.. We conducted a season‐long, standardized survey of dice snakes (Natrix tessellata) along the northern shore of Lake Como (Italy) to quantify Oo and ophidiomycosis prevalence, identify the circulating strain, and explore the association with environmental, morphological and behavioral traits.

    Concentration Assay:

    Article Title: Ophidiomycosis Prevalence and Disease Ecology in a Natrix tessellata (Laurenti, 1768) Population From Northern Italy.
    Article Snippet: Fungal pathogens pose a growing threat to vertebrate biodiversity.. In snakes, Ophidiomyces ophidiicola (Oo) has garnered particular concern, although its impact in Europe remains poorly understood.. We conducted a season‐long, standardized survey of dice snakes (Natrix tessellata) along the northern shore of Lake Como (Italy) to quantify Oo and ophidiomycosis prevalence, identify the circulating strain, and explore the association with environmental, morphological and behavioral traits.



    Similar Products

    96
    Bio-Rad bio rad cfx 193 opus 96
    Bio Rad Cfx 193 Opus 96, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/CFX96+Touch+Deep+Well+Real-Time+PCR+Detection+System/pm42096515-90-12-12
    Average 96 stars, based on 1 article reviews
    bio rad cfx 193 opus 96 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Bio-Rad real time pcr system
    Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pm41949155-130-29-32
    Average 94 stars, based on 1 article reviews
    real time pcr system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad cfx opus 96 real time pcr system
    Cfx Opus 96 Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pm41461597-98-5-11
    Average 94 stars, based on 1 article reviews
    cfx opus 96 real time pcr system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad cfx opus 96 dx real time pcr system
    Cfx Opus 96 Dx Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pmc12345006-130-39-46
    Average 94 stars, based on 1 article reviews
    cfx opus 96 dx real time pcr system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Bio-Rad bio rad cfx opus real time pcr system
    Bio Rad Cfx Opus Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Hard-Shell+96-Well+PCR+Plates/10__1007_slash_s10499___025___02385___y-73-5-5
    Average 96 stars, based on 1 article reviews
    bio rad cfx opus real time pcr system - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Bio-Rad real time pcr detection system
    Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pm41308298-54-27-32
    Average 94 stars, based on 1 article reviews
    real time pcr detection system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad cfx opus 96 real time pcr system bio rad
    Cfx Opus 96 Real Time Pcr System Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pmc12628119-113-18-24
    Average 94 stars, based on 1 article reviews
    cfx opus 96 real time pcr system bio rad - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad cfx opus96 real time pcr detection system
    Cfx Opus96 Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pmc12312117-117-28-34
    Average 94 stars, based on 1 article reviews
    cfx opus96 real time pcr detection system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Bio-Rad cfx opus96 real time pcr system
    Cfx Opus96 Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+opus+96+real+time+pcr+system/Termociclador+CFX+Opus+96+Real-Time+PCR+Detection+System/pmc12296449-167-5-10
    Average 94 stars, based on 1 article reviews
    cfx opus96 real time pcr system - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results